pten 588 (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
96
Structured Review
Cell Signaling Technology Inc
pten 588
Pten 588, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 684 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pten+588/PTEN+(D4%2E3)+XP+Rabbit+mAb/pm41932441-295-0-17
Average 96 stars, based on 684 article reviews
Pten 588, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 684 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pten+588/PTEN+(D4%2E3)+XP+Rabbit+mAb/pm41932441-295-0-17
Average 96 stars, based on 684 article reviews
pten 588 - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Bioprocessing:Article Title: Genome-wide profiling identifies the genetic dependencies of cell death following EGFR inhibition. Article Snippet: Afterward, genetic perturbations were validated via western blot. sgRNA 577 sequences cloned into px330 were: 578 PTEN - 5’ – ACCGCCAAATTTAATTGCAG – 3’ 579 CASP3 – 5’ – TCTTGGCGAAATTCAAAGGA – 3’ 580 APAF1 – 5’ – GTGAAGGTGGAGTACCACAG – 3’ 581 PLCG1 – 5’ – ATAGCGATCAAAGTCCCGTG – 3’ 582 PDK1 – 5’ – GTCACAAGAACTTCGACCAG – 3’ 583 PIK3CA – 5’ – GAATAGGCAAGTCGAGGCAA – 3’ 584 585 586 Immunoblotting 587 Immunoblotting was performed using the LiCOR Odyssey CLx infrared scanner. .. PTEN 588 (9188T), BIM (2933), Mcl-1 (5453S), and |